Do podanej nici dna dopisz nić komplementarną

Pobierz

2017-06-10 12:05:01 Właściciel domu chcąc oszczędzać energię elektryczną, dokonał kolejno trzech usprawnień, które obniżyły wydatki na ogrzewanie domu kolejno o 20%, o 25% i o 55%.Do podanej nici DNA napisz: a) nić komplementarną DNA, a dla nici komplementarnej nić zreplikowaną b) do zreplikowanej napisz nic mRNA AAACCGTTGACGTAC Napisz list do koleżanki/kolegi (50-100 słów) Poinformuj, ze w czasie ostatniego weekendu odwiedziła cię dawno niewidziana kuzynka.Do podanej nici DNA napisz: a) nić komplementarną DNA, a dla nici komplementarnej nić zreplikowaną b) do zreplikowanej napisz nic mRNA AAACCGTTGACGTAC Programy muszą być napisane w programie C++ (konstrukcja z if) 3.1. Podaj genotypy tych osób i określ jakie jest prawdopodobieństwo że ich dziecko będzie bez piegów.. 2012-03-18 13:10:07; Do wypowiedzi dopisz komentarz (jest niżej) 2011-11-14 21:09:18; Dopisz do wyrazów podanych niżej wyrazy pokrewne zwierające ó .ODWDZIECZE SIĘ!. Nić matrycowa: TAC GGA TAT CCA TGA ATCNić komplementarna: Odpowiedź na zadanie z Biologia na czasie 1.. W laboratorium poddano badaniu cząsteczkę DNA.. autor: pytajnikkk » sob wrz 04, 2010 17:29.. DNA: ACT GGC TAT GCA ATA mRNA: UGA CCG AUA CGU UAU jest to 5 aminokwasów, rozdzieliłam spacją by odróżnić kolejne, ale normalnie zapisuje się w jednym ciągu .Do podanej nici DNA dopisz nić komplementarną..

Do podanej nici DNA dopisz nić komplementarną.1.

a) Sekwencje nici DNA: TACAAAGCTTAGCGCCTATAC Nazwa procesu: b)Sekwencja nici mRNA: Nazwa procesu: c)Kolejność aminokwasów w białku:Opracowania zadań z popularnych podręczników do matematyki, fizyki, chemii, biologii, geografii i innych.. Dopisz nić komplementarną do podanej w cząsteczce DNA: Przedmiot: Biologia / Liceum: 2 rozwiązania: autor: nowa1 22.3.2011 (10:59) DO PODANEJ NICI POLINUKLEOTYDOWEJ:CACGCATTAACGGAATC a)dopisz nić Przedmiot: Biologia / Liceum: 1 rozwiązanie: autor: jula505 8.5.2012 (12:33)Do podanej nici DNA dopisz komplementarną mRNA i określ z ilu aminokwasów składa się ta nić.. 2011-09-10 18:40:33Przepisywanie informacji genetycznej polega na tworzeniu nici RNA o sekwencji komplementarnej do danego fragmentu DNA?. Witam !. Portal i aplikacja edukacyjna gdzie szybko znajdziesz odpowiedzi i pomoc na zadania.. Oblicz, ile nukletydów z guaniną powinno być w tym fragmencie cząsteczki..

Dopisz nić komplementarną do podanej w cząsteczce DNA: TACTACATGATATCGGCACTTAG.

Uporządkuj podane cechy wpisując je do tabeli: Cechy recesywne / Cechy dominujące te cechy: jasne włosy, brazowe oczy, niski wzrost, głuchota 2.. Do podanej nici DNA dopisz nić komplementarną: A G T A C T G C T. - Odrabiamy.plOpracowania zadań z popularnych podręczników do matematyki, fizyki, chemii, biologii, geografii i innych.. Proszę czekać.. 1 ocena | na tak 100%.. 2010-05-17 14:34:38 Jak odróżnić RNA od DNA ?. Proszę zapoznać się z dyskusji i odpowiedzi na pytania Do podanej nici DNA napisz: a) nić komplementarną DNA, a dla nici komplementarnej nić zreplikowaną b) do zreplikowanej napisz nic mRNA AAACCGTTGACGTAC poniżej.. ACTGGCTATGCAATADo podanej sekwencji nici DNA dopisz komplementarną sekwencję mRNA,a następnie zapisz kolejność Aminokwasów,która odpowiada sekwencji nukleotydów w mRNA.Nazwij modelowane procesy.. Zapytaj.onet.pl.answer.. Karty pracy ucznia zakres podstawowy.. a) Dopisz nić komplementarną DNA : Nić matrycowa DNA : ACTTGCAAAGCCTATAGAAC.Do podanej nici DNA napisz: a) nić komplementarną DNA, a dla nici komplementarnej nić zreplikowaną b) do zreplikowanej napisz nic mRNA AAACCGTTGACGTAC Reguła według której zasady azotowe łączą się tworząc dwuniciową cząsteczkę DNA to tzw. 3..

Dopisz do podanej nici DNA nić komplementarną.Do podanej nici DNA dopisz komplementarną mRNA i określ z ilu aminokwasów składa się ta nić.

2017-02-21 15:32:30Do podanej nici DNA napisz: a) nić komplementarną DNA, a dla nici komplementarnej nić zreplikowaną b) do zreplikowanej napisz nic mRNA AAACCGTTGACGTAC PROSZE POTRZEBUJE NA JUTRO Napisz notatke o daniu ,które uwielbiasz jeść .Twoja wypowiedź powinna sie skladac z trzech akapitoów .Do podanej nici DNA dopisz nić komplementarną : 2013-05-28 21:48:03 jak nazywa się enzym łączący fragment DNA ?. Portal i aplikacja edukacyjna gdzie szybko znajdziesz odpowiedzi i pomoc na zadania.. 2.Piegowaty mężczyzna, którego ojciec nie był piegowaty ożenił się z kobietą bez piegów.. Dopisz nić komplementarną do podanej w cząsteczce DNA: Przedmiot: Biologia / Liceum: 2 rozwiązania: autor: nowa1 22.3.2011 (10:59) Dopisz komplementarną nić DNA do Przedmiot: Biologia / Liceum: 1 rozwiązanie: autor: bea258 29.3.2011 (15:33) DO PODANEJ NICI POLINUKLEOTYDOWEJ:CACGCATTAACGGAATC a)dopisz nić Przedmiot: Biologia / Liceum: 1 rozwiązanie1.. Alele to: A. dwa geny na tę samą cechęDNA i mRNA - wątpliwości.. dopisz nić komplementarną do podanej b. napisz sekwencję łańcucha mRNA, który powstanie w wyniku procesu transkrypcji podanego odcinka DNA c. z ilu aminokwasów będzie zbudowana cząsteczka białka, powstająca w wyniku translacji tego fragmentu mRNADo podanej nici DNA dopisz nić komplementarną: 2013-05-28 21:48:03; Do podanych niżej rzeczowników dopisz przysłówki ?.

Do podanej nici DNA dopisz nić komplementarną i kolejno: nić m-RNA, antykodony t-RNA oraz odpowiadające im aminokwasy w syntetyzowanym białku.1.

Mógłby ktoś sprawdzić czy dobrze robię podane zadanie?. Zgodnie z tą zasadą cytozyna .Witam.. Nić komplementarna to:atgcctataggtacttagOgólnie w DNA kwasie deoksyrybonukleinowym A(adenina) łączy się z T(tyminą) a C(cytozyna) z G(guaninia) linka999ea linka999eaDo podanej nici DNA dopisz nić komplementarną : A T C G T A C G T. Odpowiedz.. 2013-11-28 11:25:02 Różnice DNA i RNA ?. Chciałabym zapytać czy dobrze rozmuję to oto zadanie : 1) Kolejność nukleotydów w pewnej nici DNA jest następująca : ACTTGCAAAGCCTATAGAAC.. rozwiązane.. Oblicz, ile w badanym DNA, będzie cytozyny, guaniny i tyminy.Zapisz sekwencje nukleotydow RNA komplementarna do nastepujacej sekwencji nukleotydow DNA: 2009-05-07 17:09:55; Mój kot zjadł nić 2014-03-08 19:30:33; Co to znaczy nić Ariadny?. 28.05.2013 o 21:48 rozwiązań: 3.. Portal i aplikacja edukacyjna gdzie szybko znajdziesz odpowiedzi i pomoc na zadania.. Odpowiedz.. Reforma 2019DYSKUSJA I ODPOWIEDZI..


wave

Komentarze

Brak komentarzy.
Regulamin | Kontakt